Background  Accumulating evidence shows that angiotensin II (ANG II) can be generated locally in the lung tissue and   may have autocrine and/or paracrine actions on the cellular level. In addition, ANG II precursor, angiotensinogen, as well as ANG II type 1 receptor (AT1) are also expressed in the lung tissue. Recent studies revealed that ANG II promoted acute lung injury induced by acid aspiration or sepsis, and that ANG II receptor blockade had a protective effect against acute lung injury. Therefore, the authors hypothesized that ventilator-induced lung injury  might also be exacerbated by local ANG II action, and that ANG II receptor blockade would protect the lung from ventilator-induced lung injury.

Methods   Forty Sprague-Dawley rats weighing 300–350g were randomly divided into the following experimental groups (10 rats in each group): (1) control group: rats were unventilated; (2) LVT (low volume ventilation) group:  rats were ventilated with 8 ml/kg tidal volume room air for two hours; (3) HVT (high volume ventilation) group: rats were ventilated with 40ml/kg tidal volume room air for two hours; (4) HVT+Losartan group: rats were pretreated with Losartan (30mg/kg, i.p.) prior to high volume ventilation. The samples of pulmonary tissue and lung lavage fluid were collected after experiments. The expression of angiotensinogen and AT1 receptor mRNA in lung tissue was measured by reverse transcriptase-polymerase chain reaction (RT-PCR); Apoptosis of the lung cells was assayed with terminal deoxynucleodityl transferase-mediated nick-end labeling (TUNEL) method; Lung pathological changes were examined with optical microscopy; Total protein, wet/dry ratios (W/D), myeloperoxidase (MPO) activity and neutrophil counts of the lung tissue or lavage fluid were measured with corresponding methods.

Results   Compared with control or low volume ventilation, high volume ventilation caused significant ventilator-induced lung injury and increased the expression of angiotensinogen and AT1 receptor mRNA in the lung. Total protein, the number of apoptotic cells, W/D ratio, MPO activity and neutrophil counts were significantly higher in HVT group than in LVT or control group. Pretreatment with Losartan attenuated ventilator-induced lung injury, and prevented the increase in total protein , the number of apoptotic cells, W/D ratio, MPO and neutrophil counts caused by high volume ventilation.

Conclusion   Our study indicates that high volume ventilation causes remarkable lung injury and upregulates angiotensinogen and AT1 receptor expression of in the lung, and that Losartan , a selective inhibitor of subtype AT1 receptors for angiotensin II , can relieves acute lung injury caused by high volume ventilation.

It has been shown that some mechanical ventilation strategies can cause ventilator-induced lung injury (VILI), which is characterized by intense cellular infiltration, pulmonary edema, hyaline membrane formation, and surfactant dysfunction (1, 2). However, the mechanism of VILI remains to be elucidated. Recently, a mechanism of inflammatory injury, termed “biotrauma,” has been elaborated in which the mechanical stress produced by mechanical ventilation leads to the upregulation of an inflammatory response (3), as evidenced by neutrophil infiltration in the lung and increased bronchoalveolar lavage levels of host inflammatory mediators (4-6).However, the detailed mechanism behind the “biotrauma” in VILI is not well understood yet.

Local rennin-angiotensin system (RAS) has been described for a number of tissues, in which the ANG II production is independent of its circulating precursor (7, 8). The existence of a pulmonary RAS and high ANG II concentrations have been demonstrated in normal rat lung (9). In addition, angiotensinogen and AT1 receptors are also expressed in the lung tissue (10-12).

It has been demonstrated that ANG II is mitogenic for lung cells via activation of the AT1 receptor and plays an important role in the fibroproliferative response to lung injury (13,14). ANG II has also been shown to regulate the apoptosis of alveolar epithelial cells (15), modulate tissue neutrophil accumulation directly or indirectly by stimulating release of neutrophil chemoattractants from parenchymal cells (16,17). Furthermore, AT1 receptor inhibitors have been shown to protect from acute lung injury induced by acid aspiration, sepsis or N-formylmethionyl leucyl-phenylalanine (fMLP) via a number of potential mechanisms(18,19). Therefore, we hypothesized that VILI could be promoted by local ANG II action. We tested this hypothesis by investigating the pulmonary expression of the angiotensinogen and AT1 receptors mRNA in a rat model of VILI. Meanwhile, we assessed the effect of Losartan, a selective inhibitor of AT1 receptor, on the pulmonary edema and neutrophil sequestration induced by high ventilation.

Materials and Methods

Animal.

Adult 300 to 350g male Sprague-Dawley rats (n=40) were purchased from animal center of TongJi Medical College, Huazhong University of Science and Technology. All rats were anesthetized with pentobarbital (50 mg/kg, intraperitoneal injections). Subsequently, the animals were tracheostomized and ventilated with Harvard small animal ventilator, and Control, nonventilated rats were anesthetized and killed immediately. Muscle relaxation was induced by the intramuscular injection of pancuronium bromide (3 mg/kg). The protocols was approved by animal center of TongJi Medical College.

Experimental protocol.

Forty Sprague-Dawley rats weighing 300–350g were randomly divided into the following experimental groups: unventilated animals (as a control, anaesthetized only, n=10); low volume ventilation {LVT group,8 ml/kg tidal volume, +2cm H2O positive end expiratory pressure (PEEP), 40br/min, n=10}, with room air for two hour; high volume ventilation (HVT group, 40ml/kg tidal volume, no PEEP, 40 br/min, n=10), with room air for two hour; high volume ventilation pretreated with Losartan(HVT+Losatan group, 40ml/kg tidal volume, no PEEP, 40 br/min, n=10), with room air for two hour, and all rats in HVT+Losartan received intraperitoneal injections of Losartan(Cayman) 30mg/kg thirty minutes before experiments. Animals were killed at the end of experiment. The unventilated control group was killed immediately after tracheotomy in an identical way. The thorax was opened and lungs were collected. The left lung was lavaged for Protein and Myeloperoxidase assay, and the right lung tissue samples were obtained for the measurement of the wet/dry weight ratio and histologic and biochemical analysis.

Analysis of lung water.

Lungs were removed en bloc, and large airways were removed. The one of right lungs were weighed and then dried in an oven at 80°C for 48 h. If there were no changes in the dry lung weight at 24 and 48 h, the weight at 48 h was used. Lung wet-to-dry weight ratio was used as an index of pulmonary edema formation.

Lung lavage.

After death, the lungs were removed en bloc, and polyethylene tubing was inserted into the left lung and secured. The left lung was lavaged three times with 2 ml of 0.9% NaCl. The effluents were pooled and centrifuged at 2,000 rpm for 10 min. Supernatants were frozen at -80°C.

Protein concentration in bronchoalveolar lavage fluid(BALF).

The protein concentration in the lavage fluid was determined by using a Bio-Rad protein assay kit (Bio-Rad Laboratories) with bovine serum albumin (Sigma-Aldrich) as a standard.

Myeloperoxidase assay.

MPO activity was determined in cell-free BALF according to a previously described method (20), with minor modifications. Aliquots of 50 µL of cell-free BALF were mixed in microtiter plates with 200 µL of O-dianisidine dihydrochloride (1.25 mg/mL in phosphate-buffered saline) plus BSA (0.1% wt/vol) and that contained H2O2 (0.05% = 0.4 mM). The MPO activities are expressed as changes in absorbance at 450 nm.

Evaluation of Degree of VILI and Neutrophil Infiltration.

Pulmonary tissue samples from the right lower lobe were fixed in 10% buffered formalin, embedded in paraffin. And stained with hematoxylin and eosin for the determination of the severity of lung injury. Samples were assessed by a pathologist blinded to the grouping of the rats. Acute lung injury(ALI) was scored based on: (1)alveolar capillary congestion; (2) hemorrhage; (3) infiltration or aggregation of neutrophils in the airspace or the vessel wall; and (4) thickness of the alveolar wall / hyaline membrane formation (21). Each item was graded according to the following five-point scale: 0 = minimal (little) damage; 1 = mild damage; 2 = moderate damage; 3 = severe damage; and 4 = maximal damage (21). The degree of VILI was assessed by sum of scores of items from 0 to 16 in five high-power fields (HPF, ×400), randomly. The average of sum of each field score was compared among groups.

To evaluate more accurately the recruitment of neutrophil in lung tissue, we stained sections with 3,3’-diaminobenzidine and counterstained with toluidine blue. The neutrophil, which were observed as peroxidase-positive blue cytoplasmic cells, were counted in ten consecutive HPFs (×400) (22).

Quantification of apoptosis in lung tissues by TUNEL 

The semiquantification of apoptotic cells in lung tissue was carried out by in situ TUNEL using the Apop Tag Peroxidase In Situ Cell Death Detection Kit (Biosource) according to the manufacturer's protocol. The number of positive signals in each section was evaluated by 3 independent pathologists using light microscopy. The apoptosis index (AI) was calculated. AI is a measure of the number of positive cells in each 100 cells counted in 5 different blocks in the same section[23].

Reverse Transcriptase-Polymerase Chain Reaction of angiotensinogen and AT1 receptor mRNA

Total RNA from rat lung was isolated by guanidium thiocyanate-phenol-chloroform extraction according to the method described by Chomczynski and Sacchi(24). A 1-μg portion of total RNA was subjected to first-strand cDNA synthesis in a 25-μl reaction mixture containing avian myeloblastosis virus reverse transcriptase (10 U), dNTP mixture (2 mM concentrations of each dNTP), oligo(dT)primers (10μM), and reaction buffer as supplied with the enzyme (50 mM Tris-HCl (pH 8.3), 50 mM KCl, 10 mM MgCl2, 0.5 mM spermidine, and 10 mM DDT). The samples were incubated at 42°C for 60 min followed by enzyme denaturation step at 94°C for 2 min. The reverse transcription mixture was diluted with 25μl of RNase-free water and stored at -80°C for use in PCR. All reagents above were obtained from Promega(Promega). PCR was performed on 4μl of reverse transcriptase product using Ready-To-Go PCR beads (Amersham Pharmacia Biotech), containing Taq DNA polymerase, dNTP, buffer, and 0.5μM concentrations of each gene-specific forward and reverse primers (Sangon, Shanghai, China) in a total volume of 25μl. Gene-specific oligonucleotide primers were designed from published rat sequences. For amplification of ANG cDNA, the sense primer 5’ CCTCGCTCTCTGGACTTATC 3’and the antisense primer 5’ CAGACACTGAGGTGCTGTTG 3’, Which yields a PCR product of 226 bp. For amplification of AT1 receptor cDNA, the sense primer 5’GTAGCCAAAGTCACCTGCAT 3’ and the antisense primer 5’ TCAGGCAATTGTTAAAATAAGCTAT3’, which yields a PCR product of 463 bp. For glyceraldehyde phosphate dehydrogenase(GAPDH), the sense primer 5’ TGAAGGTCGGTGTCAACGGATTTGGC 3’ and the antisense primer 5’ CATGTAGGCCATGAGGTCCACCAC 3’, which yields a PCR product of 983 bp. After an initial denaturation at 95℃ for 5 min, amplification was conducted through 30–35 cycles of denaturation at 94℃ for 30s, annealing at 55℃(GAPDH) 、57℃(AT1) and 60℃ (ANG) for 30s and extension at 72℃ for 45 s. Final extension was at 72℃ for 7 min followed by a final hold at 4°C. Negative controls (PCR mixture without cDNA) and positive controls (PCR mixture with a standard cDNA sample) were included in preliminary PCR runs. The PCR products were separated by electrophoresis using 1.5% agarose gels stained with ethidium bromide to visualize cDNA products. Bands of each target transcript were visualized by ultraviolet transillumination and captured using a digital camera. ODs for each band were quantified by image analysis software (Imagemaster). The level of gene expression of each transcript was normalized to that of the housekeeping gene GAPDH.

Statistical analysis.

All the data are expressed as the mean ± standard deviation. Statistical comparisons were made using the Kruskal-Wallis test followed by Mann-Whitney U test. A p-value of <0.05 was taken to be statistically significant.

Results

Lung Wet-to-Dry Weight Ratios and Protein in BALF. The lung wet-to-dry weight ratios and protein in BALF were significant differences between the Control, LVT, HVT, and HVT+Losartan groups (Fig.1 or Fig.2). The HVT group had a significantly higher lung wet-to-dry weight ratios and protein in BALF than the Control and LVT group. However, high volume ventilation pretreated with Losartan (HVT+Losartan group) significantly decreased the lung wet-to-dry ratios and protein in BALF when compared with the HVT group(Fig.1 or Fig.2).

Histologic Examination. After mechanical ventilation, the HVT group showed high levels of intra-alveolar exudates, hyaline membrane formation, inflammatory cell infiltration, intra-alveolar hemorrhage, and interstitial edema. However, significant ALI findings were absent and only mild inflammatory cellular infiltration was present in the Control and LVT group. The HVT+Losartan group displayed moderately increased inflammatory cellular infiltration and intra-alveolar hemorrhage(Fig. 3). The degrees of VILI, as expressed by ALI scores, were significant differences between the control, LVT, HVT, and HVT+Losartan groups(Fig.4). The HVT group showed a significantly higher ALI scores than the Control and LVT group. However, high volume ventilation pretreated with Losartan (HVT+Losartan group ) significantly decreased ALI scores when compared with the HVT group. (Fig.4)

MPO Activity in BALF . The optical densities of the MPO activity in BALF were significant differences between the control, LVT, HVT, and HVT+Losartan groups (Fig. 5). The HVT group showed significantly higher MPO activity than the Control and LVT groups. In comparisons with the HVT group, the HVT+Losartan group showed significantly lower level of MPO activity (Fig. 5).

Neutrophil Infiltration in lung tissue. The levels of neutrophil infiltration were also significant differences between the control, LVT, HVT, and HVT+Losartan groups (Fig. 6). The HVT group showed significantly higher neutrophil infiltration than the Control and LVT groups. In comparisons with the HVT group, high volume ventilation pretreated with Losartan (HVT+Losartan group) significantly decreased the level of neutrophil infiltration in lung tissue(Fig. 6).

Reverse Transcriptase-Polymerase Chain Reaction of angiotensinogen and AT1 receptor mRNA. The expression levels of angiotensinogen and AT1 receptor mRNA were significantly different between the Control, LVT and HVT group(Fig. 7). The angiotensinogen and AT1 receptor mRNA expression levels in the HVT group significantly increased when compared with the Control and LVT groups. (Fig. 7A.7B).

Quantification of apoptosis in lung tissues by TUNEL.  Apoptosis in lung tissues is expressed with apoptosis index(AI), which is a measure of the number of positive cells in each 100 cells counted in 5 different blocks in the same section. AI were significantly different between the Control, LVT, HVT and HVT+Losartan group(Fig. 8). AI in the HVT group significantly increased when compared with the LVT and Control group. But in comparisons with the HVT group, high volume ventilation pretreated with Losartan (HVT+Losartan group) significantly decreased the level of AI in lung tissues. (Fig. 8).

Discussion

Mechanical ventilation (MV) has become an indispensable therapeutic modality for patients with respiratory failure. However, it is well recognized that MV could cause a number of serious complications. Initially, the focus of the research in such injury was primarily on the role of pressure and volume causing barotrauma leading to the clinical conditions of pneumothorax and pneumomediastinum (25). Subsequently, researches found that the stretching of the lung by mechanical ventilation with high tidal volumes could cause acute lung injury, characterized by severe damage to the alveolar–capillary barrier and pulmonary edema, so-called “volutrauma” (26). This type of lung injury is manifested by an increased endothelial and epithelial barrier permeability in the lung. The mechanism of such an increase in permeability is not well understood. It was also reported that MV may initiate and propagate inflammatory response in the lung by increasing neutrophil infiltration and the release of proinflammatory cytokines (such as tumor necrosis factor (TNF-α), macrophage inflammatory protein (MIP-2) and interleukin ( IL-1β) in the lung (4-6,27-28) , which is called biotrauma. In addition to inflammatory response, oxidative stress was also believed to play an important role in biotrauma.  Researches has revealed that cyclic mechanical strain may enhance reactive oxygen species production by increasing NADPH oxidase activity in pulmonary epithelial cells, which would increase the release of cytokines, such as IL-1β, IL-6, and TNF-α (29-30).

Increasing evidences indicate that Ang II probably play an important role in vascular inflammatory response. Ang II receptors are categorized  into two main subtypes: AT1 and AT2 receptors. Ang II-induced vascular inflammation is mainly mediated via stimulation of AT1 receptors (31). Studies have found that Ang II can directly enhance the expression of P-, E-, L-selectins, Intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) on vascular endothelial and smooth muscle cells (32-36). Ang II has also been shown to increase leukocyte chemotaxis and augment the production of inflammatory cytokines and chemokines in vitro or in vivo, such as monocyte chemoattractant protein-1 (MCP-1), IL-8, IL-6, TNF-α (37-40). NF-κB is the main transcription factor responsible for the regulation of several inflammatory genes, such as those for cytokines, chemokines, and adhesion molecules. In vitro, increased activation of NF-κB in response to Ang II has been shown in several cell types, including vascular smooth muscle cells (VSMCs), endothelial, glomerular, tubular, and mononuclear cells [41-42]. Thus ANG II probably increases the expression of inflammatory genes by activating NF-κB. In addition, it was also found that ANG II induced oxidative stress by increasing the activity of NADPH oxidase in vascular endothelial cells (35).

Although most researches on the roles of ANG II in inflammation were focused on vascular smooth muscle cells and endothelial cells, it stands to reason that ANG II may also enhance the expression of inflammatory cytokines and chemokines in other parenchymal cells and may be implicated in the inflammatory response of other tissues. In recent years, some researches have suggested that ANG II probably play an important role in acute lung injury. ANG II can induce the fibroproliferative response to acute lung injury (14). ANG II also induces apoptosis in human and rat alveolar epithelial cells (15). In vivo, studies have confirmed that the concentration of ANG II is significantly elevated in lung tissue and that ANG II receptor inhibitor could attenuate lung oedemas, lung cell apoptosis and neutrophil sequestration in acute lung injury (14,18,19,43). However, to our knowledge, so far there is no report regarding the role of ANG II on VILI. Therefore, we hypothesized that VILI might be promoted by local ANG II action and be alleviated  by ANG II receptor inhibitors.

In the current study, we showed that mechanical ventilation with high volume produced acute lung injury, as manifested by lung edema, neutrophilia, and significantly increase apoptosis of alveolar epithelial cells. Besides surfactant secretion, the alveolar epithelium is a tight barrier that normally restricts the movement of proteins and fluid from the interstitium to the alveolar spaces. Excess apoptosis in alveolar epithelial cells will damage the function of alveolar epithelium. Our present data also shows that high volume ventilation significantly upregulates the expression of angiotensinogen and AT1 receptor mRNA in the lung tissue. angiotensinogen is the precursor of ANGII, thus, high level of angiotensinogen due to ventilator-induced lung injury, to some degree, may reflect the increase of ANGII. We suppose that upregulation of ANG II and AT1 receptor may contribute to VILI because of the role of ANG II and AT1 receptor in inflammatory response, oxidative stress and lung cell epithelial apoptosis. Although it is not very clear whether ANG II can upregulate the expression of inflammatory cytokines and chemokines in lung epithelial cells, we assume that ANG II may at least play an important role though lung endothelial cells in ventilator-induced lung injury because capillary vessel endothelial cells play a key role by mediating infiltration of neutrophil. Upregulation of ANG II probably stimulates the release of inflammatory cytokines and chemokines from lung vascular endothelial cell in VILI. However, the mechanism of upregulation of angiotensinogen and AT1 receptor remains to be further clarified.  In the meantime, our experiments show that Losartan, a selective inhibitor of AT1 receptors, can attenuate lung edema, neutrophil sequestration and lung cell apoptosis caused by VILI. We suppose that the protection of Losartan probably relate to blocking the action of ANG II. Certainly, the role of ANG II on lung epithelial cells needs a further clarify.

In conclusion, our experiments demonstrate that mechanical ventilation with high volume can remarkably cause VILI, and that Losartan, a selective inhibitor of subtype AT1 receptors for angiotensin II, can relieve acute lung injury caused by high volume ventilation.