<?xml:namespace prefix = o ns = "urn:schemas-microsoft-com:office:office" /> 

Penglin Ma，MD，PhD；Dechang Chen，MD；Jiaqi Pan，MD；Bin Du，MD

　　Objective：To determine the allele frequencies and genotype distribution of interleukin－1_，interleukin－1_，and interleukin－1 receptor antagonist gene polymorphism in septic patients.

 <?xml:namespace prefix = o ns = "urn:schemas-microsoft-com:office:office" />

　　MATERIALS AND METHODS

　　Patients and Controls. After approval of the institutional ethics committee and after written informed consent was obtained from the patient or first－degree relative，60 consecutive patients with a diagnosis of sepsis were studied in the setting of the intensive care unit，Peking Union Medical College Hospital.Patients with underlying autoimmune diseases were excluded. The diagnosis of sepsis met the criteria by the American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference Committee. Sixty healthy volunteers served as controls.Acute Physiology and Chronic Health Evaluation II score was obtained within 24 hrs after study entry. Multiple Organ Dysfunction Syndrome score was calculated. Demographic data，infectious focus，type of pathogen，and patient outcome also were recorded.Each patient’s genomic DNA was extracted by a simple salting out procedure from peripheral blood nucleated cells （9）.

    IL－1a Polymorphism. The polymorphic region within intron 6 of the IL－1A gene containsa variable number of tandem repeats of 46 base pairs （bp）. It was amplified by using the polymerase chain reaction （PCR） （10）. The following PCR protocol was used：50 pmol of each primer （primer 1，5'－GCCTCTAGACTCATAGAACTTAGTC－3'；primer 2，5'－GTGAGGTCAGGCCATTGCACTG－3'）；5 units of Taq plus I DNA polymerase；250 _M each of four deoxynucleotide－triphosphates （adenine，cytidine，guanosine，thymidine），and 2 mM magnesium chloride. The initial denaturation （98°C，2 mins） was followed by 35 cycles of a three－temperature PCR segment consisting of denaturation （96°C，1 min），annealing （58°C，1 min），and extension （74°C，6 mins）. The size of the amplified product was determined by electrophoresis on a 0.9％ agarose gel stained with 0.1％ ethidium bromide. Alleles are termed according to the rank of frequencies in healthy individuals. The alleles A1，A2，A3，A4，A5，A6，A7 represent different repeats of 46 bp tandem repeat；their sizes are 800 bp，1200 bp，760 bp，940 bp，620 bp，1080 bp，and 660 bp，respectively.

    AvaI IL－1B Polymorphism. The region containing the AvaI polymorphic site at position －511 of the IL－1B gene was amplified by PCR （8）. The oligonucleotides 5'－TGGCATTGATCTGGTTCATC－3' and 5'－GTTTAGGAATCTTCCCACTT－3'flanking this region were used as primers. The following PCR protocol was used： An initial denaturation was conducted at 95°C for 3 mins，followed by 35 cycles of a three－temperature PCR segment consisting of 1 min denaturation （1 min，95°C），annealing （1 min，55°C），and extension （1 min，74°C），and finally 74°C for 6 mins. The PCR products （20 _L） were digested with 6 units of AvaI restriction enzyme （New England Biolabs，Beverly，MA） at 37°C for 3 hrs. Fragments were analyzed by electrophoresis on a 1.5％ agarose gel stained with ethidium bromide. This gave products of 190 bp + 114 bp （B1） and 304 bp （B2）.

    IL－1ra Polymorphism. The polymorphic region within intron 2 of the IL－1ra gene contains a variable numbers of tandem repeats of 86 bp. It was amplified by using PCR. Genomic DNA （2 ng） served as template in a 50－uL PCR reaction. This reaction contains the following：50 pmol of each primer （primer 1，5'－ CTCAGCAACACTCCTAT－3'；primer 2，5'－TCCTGGTCTGCAGGTAA－3'）；5 units of Taq DNA polymerase and 1x reaction buffer （Promega，Madison，WI）；200 uM each of four deoxynucleotide－triphosphates （adenine，cytidine，guanosine，thymidine），and 2 mM magnesium chloride. The initial denaturation （96°C，1 min） was followed by 35 cycles of a three－temperature PCR segment consisting of denaturation （94°C，1 min），annealing （55°C，1 min），and extension （72°C，1 min）. The size of the amplified product was determined by electrophoresis on a 1.5％ agarose gel stained with 0.1％ ethidium bromide. Alleles are termed according to the rank of frequencies in healthy individuals. The alleles RN1，RN2，RN3，RN4，and RN5 represent four repeats，two repeats，five repeats，and three repeats of 46 bp tandem repeat；their sizes are 410 bp，240 bp，500 bp，325 bp，and 595 bp，respectively.

    Statistical Analysis.Statistical analysis of the genotype distributions and allele frequencies of the IL－1a，IL－1B，and IL－1ra gene polymorphisms was done by Fisher’s exact test （two－sided）. Univariate predictors of mortality of septic patients were sought. The chi－square test and Fisher’s exact test were used for the categorical predictors as appropriate，and univariate logistic regression analysis was used for the continuous predictors. SPSS for Windows version 8.0.0 （SPSS，Chicago，IL） was used for data analysis.

 <?xml:namespace prefix = o ns = "urn:schemas-microsoft-com:office:office" />

　　RESULTS

　　This study included 60 patients suffering from sepsis. The demographic data of the patients and healthy control are shown in Table 1. Mean age of patients was 58.3 yrs，whereas the control group had a mean age of 24.5 yrs （p ＜ .05）. Underlying diseases were peritonitis （n＝25），pneumonia （n＝22），acute pancreatitis （n＝3），biliary tract infection （n＝5），bloodstream infection （n＝2），meningitis （n＝2），and surgical site infection （n＝1）.

    Genotypes and allele frequencies of the three genomic polymorphisms of the IL－1 gene family were analyzed in septic patients and in healthy controls. Patients did not show a significantly different frequency of the allele IL－1A gene polymorphism compared with healthy controls （p＞ .05）. The genotype distributions were also comparable between patients and normal individuals as well （Table 2）. The rare alleles IL－1a A5，A6，and A7 were not detectable in either patients or controls.

    In contrast，the allele B2 frequency of AvaI polymorphism of the IL－1B gene showed a trend of increase in septic patients （p .05）. Compared with healthy individuals，patients had a slightly elevated frequency of IL－1BB2 homozygotes and IL－1BB1/B2 heterozygous genotype，although this was not statistically significant.

    Patients showed a significantly higher frequency of the allele IL－1ra RN2 of the IL－1ra gene polymorphism （p＜ .01）.This allele is defined by two repeats of a region containing variable numbers of a tandem repeat within intron 2. The frequency of the IL－1ra RN2 homozygotes was elevated in the patient group （p＜ .05；Table 3）. The rare allele IL－1ra RN5 was not detectable in either patients or healthy controls.

    Analysis of linkage between alleles IL－1ra RN2 and alleles of the IL－1a intron 6 VNTR or IL－1B AvaI polymorphisms showed an equal distribution of IL－1ra alleles in carriers of the different IL－1a or IL－1B alleles （Table 4），which suggested that the results of our study were not affected by unsuspected linkage between the polymorphisms studied.

    Predictors of mortality in septic patients by univariate analysis revealed an increased mortality rate in patients with more severe underlying diseases （higher Acute Physiology and Chronic Health Evaluation II and Multiple Organ Dysfunction Syndrome score），such as those with pneumonia. Furthermore，noncarrier state of allele IL－1a A1，IL－1B B1，or IL－1ra RN1 and carrier state of IL－1a A2，IL－1B B2，or IL－1ra RN2 are also risk factors for mortality in patients with sepsis. In addition，patients with genotype of IL－1a A1/A1，IL－1B B1/B1，or IL－1ra RN1/RN1 as well as those with Gram－negative bacilli other than Pseudomonas as the major pathogen carried a significantly lower risk of death，whereas those with genotype of IL－1a A2/A2，IL－1B B1/B2，IL－1_ B2/B2，IL－1ra RN1/RN2，or IL－1ra RN2/RN2 were more likely to die of sepsis （Table 5）.

    Compared with other patients，patients with IL－1a A2 and IL－1ra RN2 alleles were at a higher risk of more severe disease and death，shown as a higher Acute Physiology and Chronic Health Evaluation II score （17.3  5.0） and Multiple Organ Dysfunction Syndrome score （7.9  3.0），as well as a higher mortality rate （65％）. This suggests a possible interaction between IL－1a A2 and IL－1ra RN2 alleles on the severity of sepsis and clinical outcome. Further analysis suggests that a similar interaction exists between IL－1B B2 and IL－1ra RN2 alleles and between IL－1a A2 and IL－1B B2 alleles （Table 6）.

 <?xml:namespace prefix = o ns = "urn:schemas-microsoft-com:office:office" />

REFERENCES

1. Bone RC： The pathogenesis of sepsis. Ann Intern Med 1991；115：457－469

2. Dinarello CA： Biologic basis for interleukin－1 in disease. Blood 1996；87：2095－2147

3. Arend WP，Malyak M，Guthridge CJ，et al：Interleukin－1 receptor antagonist： Role in biology. Annu Rev Immunol 1998；16：27－55

4. Bernal W，Donaldson P，Wendon J： Proinflammatory cytokine genomic polymorphism and critical illness. In： Yearbook of Intensive Care Medicine. Vincent JL （Ed）.Berlin，Springer，1999，pp 10－18

5. Nemetz A，Nosti－Escanilla MP，Molnar T，et al： IL1B gene polymorphisms influence the course and severity of inflammatory bowel disease. Immunogenetics 1999；49：527－531

6. Perrier S，Coussediere C，Dubost JJ，et al：IL－1 receptor antagonist （IL－1RA） gene polymorphism in Sjogren’s syndrome and rheumatoid arthritis. Clin Immunol Immunopathol 1998；87：309－313

7. Blakemore AI，Tarlow JK，Cork MJ，et al： Interleukin－1 receptor antagonist gene polymorphism as a disease severity factor in systemic lupus erythematosus. Arthritis Rheum 1994；37：1380－1385

8. Fang XM，Schroder S，Hoeft A，et al： Comparison of two polymorphisms of the interleukin－1 gene family： Interleukin－1 receptor antagonist polymorphism contributes to susceptibility to severe sepsis. Crit Care Med 1999；27：1330－1334

9. Miller SA，Dykes DD，Polesky HF： A simple salting out procedure for extracting DNA

from human nucleated cells. Nucleic Acids Res 1988；16：1215

10. Bailly S，di Giovine FS，Duff GW，et al： Polymorphic tandem repeat region in interleukin－1 alpha intron 6. Hum Genet 1993；91：85－86

11. Zeni F，Freeman B，Natanson C： Antiinflammatory therapies to treat sepsis and septic shock： A reassessment. Crit Care Med 1997；25：1095－1100

12. Stuber F，Petersen M，Bokelmann F，et al： A genomic polymorphism within the tumor necrosis factor locus influences plasma TNF_ concentrations and outcome of patients with severe sepsis. Crit Care Med 1996；24：381－384

13. Hurme M，Lahdenpohja N，Santtila S： Gene polymorphisms of interleukins 1 and 10 in infectious and autoimmune diseases. Ann Med 1998；30：469－473

14. Opal SM，Fisher CJ Jr，Dhainaut JF，et al：Confirmatory interleukin－1 receptor antagonist trial in severe sepsis： A phase III，randomized，double－blind，placebo－controlled，multicenter trial. Crit Care Med 1997；25：1115?1124

15. Gullo A，Berlot G： Current topics. Sepsis.Intensive Care Med 1999；25：869－871

16. Pociot F，Molvig J，Wogensen L，et al： A TaqI polymorphism in the human interleukin－1 beta （IL－1 beta） gene correlates with IL－1 beta secretion in vitro. Eur J Clin Invest 1992；22：396－402

17. Stuber F，Fang XM，Putensen C，et al： Genomic polymorphism of interleukin－1ra and tumor necrosis factor define an extended haplotype for risk assessment in severe sepsis.Crit Care Med 1998；26：A29

18. Santtila S，Savinainen K，Hurme M： Presence of the IL－1RA allele 2 （ILRN*2） is associated with enhanced IL－1beta production in vitro.Scand J Immunol 1998；47：195－198

19. Hurme M，Santtila S： IL－1 receptor antagonist （IL－1ra） plasma levels are coordinately

regulated by both IL－1ra and IL－1beta genes.Eur J Immunol 1998；28：2598－2602

20. Wilkinson RJ，Patel P，Llewelyn M，et al：Influence of polymorphism in the genes for the interleukin （IL）－1 receptor antagonist and IL－1beta on tuberculosis. J Exp Med 1999；189：1863－1874

21. Danis VA，Millington M，Hyland VJ，et al：Cytokine production by normal human monocytes： Inter－subject variation and relationship to an IL－1 receptor antagonist （IL－1ra） gene polymorphism. Clin Exp Immunol 1995；99：303－310 1050 Crit Care Med 2002 Vol. 30，No. 5